Dr. Marie Daly

Marie Maynard Daly

Biochemist and Pioneer

Marie Daly was a biochemist who overcame adversity in the 1950s to help lay the foundation for modern genetics and biochemical research. She became the first African American woman to earn a Ph.D. in chemistry in 1947, and only got more badass from there. Her research into the composition of purines and pyrimidines in DNA was integral to understanding the structure of DNA, even being cited by later Nobel Prize winners in the 60s who discovered the helical structure.

Biography

I will save myself the trouble of duplicating wikipedia and refer you to other blogs for the more biographical side of things. Dr. Daly was raised in New York and encouraged by her father to pursue a career in chemistry. She excelled academically and received fellowships during the war effort to obtain her eventual Ph.D. By all accounts an excellent student and brilliant scientist, this blog will only touch on the high points of her career but a full biography would be a great read I have no doubt.

• https://en.wikipedia.org/wiki/Marie_Maynard_Daly
• https://www.sciencehistory.org/historical-profile/marie-maynard-daly
• https://www.blackpast.org/african-american-history/clark-marie-maynard-daly-1921-2003/

Laying Bricks

One often misunderstood or poorly represented aspect of science is the mythos of the lone genius making a breakthrough. While this does happen, the true nature of science is that of a slow and relentless march forward, one painstaking step at a time. Dr. Daly’s work was one such step on the path of modern genetics and biochemical research. You can’t understand the genetic sequence if you dont understand its chemical structure, and you can’t understand the structure without knowing the components. Her research allowed later scientists to limit their scope and eventually crack the genetic code.

Cracking the code

By isolating the components from DNA you are able to determine the building blocks required to make it. This is exactly what Dr. Daly did in her 1950 paper Purine and Pyrimidine Contents of Some Desoxypentose Nucleic Acids. This paper revealed it was made of adenine, guanine, thymine, and cytosine; the AGTC you may recognize from such sequences as:

• The Start Codon

  ATG

• A portion from Covid-19

  ATTAAAGGTT TATACCTTCC CAGGTAACAA ACCAACCAAC TTTCGATCTC TTGTAGATCTTGGGATTACAG

• A common “junk” sequence found in humans

  TGGGATTACAG

Later research

This is where my weakness in biology gets revealed, while Dr. Daly has many papers with many citations most are out of the scope for me to understand well enough to explain. From protein synthesis to being the first to link cholesterol and clogged arteries, she continued to advance our understanding of the world into the modern era.

Giving thanks

From GMO crops feeding the world to the covid vaccine in todays headlines, you can thank Dr. Daly for her hard work and brilliant mind bringing us a small step closer to understanding DNA. Becoming a groundbreaking scientist worthy of note in the annals of history is hard enough on its own, to do so as a Black woman in the United States before the civil rights movement is nothing short of heroic. So please, the next time you think of DNA take a moment to thank Dr. Daly.